Osteochondrodysplastic and cardiomyopathic syndrome
- Phene ID
- 6171
- Name
- Osteochondrodysplastic and cardiomyopathic syndrome
- Phene Name
- N/A
- OMIA ID
- 2902
- Species ID
- 9913
- Characterised
- No
- Characterised Year
- N/A
Jacinto et al. (2024): "Genetic analysis [of affected Chianina cattle] identified a missense variant in TGDS [ARS-UCD1.2:Chr12:69092831A>T; NM_001101159.1: c.160T>A; NP_001094629.1: p.Tyr54Asn] and a splice-site variant in LAMA4 [ARS-UCD1.2:Chr9:38176716GAGAAAGTGAGAGAGGGAAACAGAGGGGAGAGAGAA>G; XM_024996678.1:c.153_153 + 34delAGTGAGAGAGGGAAACAGAGGGGAGAGAGAAAGAA], both of which were homozygous in the 2 cases. Parents were heterozygous and allele frequency in the Chianina population for the TGDS variant was 5% and for the LAMA4 variant was 2%." The authors conclude: "Reporting of additional similarly affected calves would help in understanding the underlying possible genetic causes and better clarify the mode of inheritance and role of the identified variants."